返回 Skills
k-dense-ai/scientific-agent-skills· MIT 内容可用

scikit-bio

Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis.

安装

与 skills.sh 相同的 Command / Prompt 安装方式


name: scikit-bio description: Biological data toolkit. Sequence analysis, alignments, phylogenetic trees, diversity metrics (alpha/beta, UniFrac), ordination (PCoA), PERMANOVA, FASTA/Newick I/O, for microbiome analysis. license: BSD-3-Clause license allowed-tools: Read Write Edit Bash compatibility: Requires Python 3.10+ and scikit-bio 0.7+ (uv pip install scikit-bio). NumPy 2.0+ is required. Optional matplotlib/seaborn/plotly for plotting; biom-format for BIOM tables; polars/anndata for table interoperability. metadata: {"version": "1.1", "skill-author": "K-Dense Inc."}

scikit-bio

Overview

scikit-bio is a comprehensive Python library for working with biological data. Apply this skill for bioinformatics analyses spanning sequence manipulation, alignment, phylogenetics, microbial ecology, and multivariate statistics.

When to Use This Skill

This skill should be used when the user:

  • Works with biological sequences (DNA, RNA, protein)
  • Needs to read/write biological file formats (FASTA, FASTQ, GenBank, Newick, BIOM, etc.)
  • Performs sequence alignments or searches for motifs
  • Constructs or analyzes phylogenetic trees
  • Calculates diversity metrics (alpha/beta diversity, UniFrac distances)
  • Performs ordination analysis (PCoA, CCA, RDA)
  • Runs statistical tests on biological/ecological data (PERMANOVA, ANOSIM, Mantel)
  • Analyzes microbiome or community ecology data
  • Works with protein embeddings from language models
  • Needs to manipulate biological data tables

Core Capabilities

1. Sequence Manipulation

Work with biological sequences using specialized classes for DNA, RNA, and protein data.

Key operations:

  • Read/write sequences from FASTA, FASTQ, GenBank, EMBL formats
  • Sequence slicing, concatenation, and searching
  • Reverse complement, transcription (DNA→RNA), and translation (RNA→protein)
  • Find motifs and patterns using regex
  • Calculate distances (Hamming, k-mer based)
  • Handle sequence quality scores and metadata

Common patterns:

import skbio

# Read sequences from file
seq = skbio.DNA.read('input.fasta')

# Sequence operations
rc = seq.reverse_complement()
rna = seq.transcribe()
protein = rna.translate()

# Find motifs
motif_positions = seq.find_with_regex('ATG[ACGT]{3}')

# Check for properties
has_degens = seq.has_degenerates()
seq_no_gaps = seq.degap()

Important notes:

  • Use DNA, RNA, Protein classes for grammared sequences with validation
  • Use Sequence class for generic sequences without alphabet restrictions
  • Quality scores automatically loaded from FASTQ files into positional metadata
  • Metadata types: sequence-level (ID, description), positional (per-base), interval (regions/features)

2. Sequence Alignment

Perform pairwise and multiple sequence alignments using the pair_align engine (introduced in scikit-bio 0.7.0), a versatile and efficient dynamic-programming aligner.

Key capabilities:

  • Global, local, and semi-global alignment (free ends configurable) in one function
  • Convenience wrappers pair_align_nucl (BLASTN-like) and pair_align_prot (BLASTP-like)
  • Configurable scoring: match/mismatch tuple or named substitution matrix; linear or affine gap penalties
  • PairAlignPath results carry CIGAR strings and convert to aligned sequences
  • Multiple sequence alignment storage and manipulation with TabularMSA

Common patterns:

from skbio import DNA, Protein
from skbio.alignment import pair_align_nucl, pair_align_prot, pair_align, TabularMSA

# Nucleotide alignment with BLASTN-like defaults
seq1, seq2 = DNA('ACTACCAGATTACTTACGGATCAGG'), DNA('CGAAACTACTAGATTACGGATCTTA')
aln = pair_align_nucl(seq1, seq2)
aln.score                                  # alignment score (float)
path = aln.paths[0]                        # PairAlignPath (repr shows CIGAR)
aligned_seqs = path.to_aligned((seq1, seq2))  # list of gapped strings

# Build a TabularMSA from the alignment path + original sequences
msa = TabularMSA.from_path_seqs(path, (seq1, seq2))

# Customize the algorithm via pair_align (default mode='global')
aln = pair_align(seq1, seq2, mode='local')                       # Smith-Waterman
aln = pair_align(seq1, seq2, sub_score=(2, -3), gap_cost=(5, 2)) # affine gaps
aln = pair_align(seq1, seq2, sub_score='NUC.4.4', gap_cost=3)    # substitution matrix, linear gap

# Protein alignment (BLASTP-like, BLOSUM62)
aln = pair_align_prot(Protein('HEAGAWGHEE'), Protein('PAWHEAE'))

# Read a multiple alignment from file and summarize
msa = TabularMSA.read('alignment.fasta', constructor=DNA)
consensus = msa.consensus()

Important notes:

  • pair_align replaces the removed SSW wrapper (local_pairwise_align_ssw, StripedSmithWaterman) and the deprecated pure-Python aligners (global_pairwise_align, local_pairwise_align_nucleotide, etc.)
  • The result is a PairAlignResult that also unpacks as score, paths, matrices (use keep_matrices=True to retain the DP matrix)
  • sub_score accepts a (match, mismatch) tuple or a matrix name (e.g., 'NUC.4.4', 'BLOSUM62'); gap_cost accepts a single number (linear) or (open, extend) tuple (affine)
  • Parse external CIGAR strings with PairAlignPath.from_cigar('1I8M2D5M2I'); score an existing alignment with align_score(...) and build a distance matrix from an MSA with align_dists(...)

3. Phylogenetic Trees

Construct, manipulate, and analyze phylogenetic trees representing evolutionary relationships.

Key capabilities:

  • Tree construction from distance matrices (UPGMA/WPGMA, Neighbor Joining, GME, BME)
  • Tree rearrangement with nearest neighbor interchange (nni)
  • Tree manipulation (pruning, rerooting, traversal)
  • Distance calculations (patristic via cophenet, Robinson-Foulds via compare_rfd)
  • ASCII visualization
  • Newick format I/O

Common patterns:

from skbio import TreeNode
from skbio.tree import nj, upgma, gme, bme, rf_dists

# Read tree from file
tree = TreeNode.read('tree.nwk')

# Construct tree from distance matrix
tree = nj(distance_matrix)

# Tree operations
subtree = tree.shear(['taxon1', 'taxon2', 'taxon3'])
tips = [node for node in tree.tips()]
lca = tree.lca(['taxon1', 'taxon2'])

# Calculate distances
patristic_dist = tree.find('taxon1').distance(tree.find('taxon2'))
cophenetic_dm = tree.cophenet()           # patristic distance matrix among tips

# Compare two trees (Robinson-Foulds)
rf_distance = tree.compare_rfd(other_tree)
# Pairwise RF distances among many trees -> DistanceMatrix
rf_dm = rf_dists([tree, other_tree, third_tree])

Important notes:

  • Use nj() for neighbor joining (classic phylogenetic method)
  • Use upgma() for UPGMA/WPGMA (assumes molecular clock)
  • GME and BME are highly scalable for large trees; refine topology with nni()
  • cophenet() (formerly tip_tip_distances) returns the patristic distance matrix; compare_rfd() is the Robinson-Foulds method (compare_wrfd/compare_cophenet for weighted/cophenetic variants)
  • lca() is the lowest common ancestor; lowest_common_ancestor remains as an alias
  • Trees can be rooted or unrooted; some metrics require specific rooting

4. Diversity Analysis

Calculate alpha and beta diversity metrics for microbial ecology and community analysis.

Key capabilities:

  • Alpha diversity: richness (sobs, observed_features, chao1, ace), Shannon, Simpson, Hill numbers (hill), Faith's PD (faith_pd), generalized PD (phydiv), Pielou's evenness
  • Beta diversity: Bray-Curtis, Jaccard, weighted/unweighted UniFrac, Euclidean distances
  • Phylogenetic diversity metrics (require tree input)
  • Rarefaction and subsampling
  • Integration with ordination and statistical tests

Common patterns:

from skbio.diversity import alpha_diversity, beta_diversity

# Alpha diversity (phylogenetic metrics take taxa= for tip-name mapping)
alpha = alpha_diversity('shannon', counts_matrix, ids=sample_ids)
faith_pd = alpha_diversity('faith_pd', counts_matrix, ids=sample_ids,
                           tree=tree, taxa=feature_ids)

# Beta diversity
bc_dm = beta_diversity('braycurtis', counts_matrix, ids=sample_ids)
unifrac_dm = beta_diversity('unweighted_unifrac', counts_matrix,
                            ids=sample_ids, tree=tree, taxa=feature_ids)

# Get available metrics
from skbio.diversity import get_alpha_diversity_metrics
print(get_alpha_diversity_metrics())

Important notes:

  • Counts must be integers representing abundances, not relative frequencies
  • The phylogenetic-metric argument is taxa= (renamed from otu_ids in 0.6.0; the old name is a deprecated alias); observed_otus is now observed_features (or sobs)
  • counts_matrix may be any table-like input (NumPy array, pandas/polars DataFrame, BIOM Table, or AnnData) via the dispatch system
  • Phylogenetic metrics (Faith's PD, UniFrac) require tree and taxa-to-tip mapping
  • Use partial_beta_diversity() for specific sample pairs, or block_beta_diversity() for large block-decomposed calculations
  • Alpha diversity returns a pandas.Series, beta diversity returns a DistanceMatrix

5. Ordination Methods

Reduce high-dimensional biological data to visualizable lower-dimensional spaces.

Key capabilities:

  • PCoA (Principal Coordinate Analysis) from distance matrices
  • CA (Correspondence Analysis) for contingency tables
  • CCA (Canonical Correspondence Analysis) with environmental constraints
  • RDA (Redundancy Analysis) for linear relationships
  • Biplot projection for feature interpretation

Common patterns:

from skbio.stats.ordination import pcoa, cca
import skbio

# PCoA from distance matrix (limit dimensions for large matrices)
pcoa_results = pcoa(distance_matrix, dimensions=3)
pc1 = pcoa_results.samples['PC1']
pc2 = pcoa_results.samples['PC2']

# Built-in scatter plot colored by a metadata column
fig = pcoa_results.plot(sample_metadata, column='bodysite')

# CCA with environmental variables
cca_results = cca(species_matrix, environmental_matrix)

# Save/load ordination results
pcoa_results.write('ordination.txt')
results = skbio.OrdinationResults.read('ordination.txt')

Important notes:

  • PCoA works with any distance/dissimilarity matrix; pass dimensions as an int (count) or a float in (0, 1] (fraction of cumulative variance to retain)
  • OrdinationResults exposes pandas-based attributes: samples, features, eigvals, proportion_explained, biplot_scores, sample_constraints
  • CCA reveals environmental drivers of community composition
  • OrdinationResults.plot() produces a matplotlib figure; results also integrate with seaborn/plotly

6. Statistical Testing

Perform hypothesis tests specific to ecological and biological data.

Key capabilities:

  • PERMANOVA: test group differences using distance matrices
  • ANOSIM: alternative test for group differences
  • PERMDISP: test homogeneity of group dispersions
  • Mantel test: correlation between distance matrices
  • Bioenv: find environmental variables correlated with distances
  • Differential abundance: ancom, dirmult_ttest, and dirmult_lme (longitudinal mixed-effects) in skbio.stats.composition

Common patterns:

from skbio.stats.distance import permanova, anosim, mantel

# Test if groups differ significantly
permanova_results = permanova(distance_matrix, grouping, permutations=999)
print(f"p-value: {permanova_results['p-value']}")

# ANOSIM test
anosim_results = anosim(distance_matrix, grouping, permutations=999)

# Mantel test between two distance matrices
mantel_results = mantel(dm1, dm2, method='pearson', permutations=999)
print(f"Correlation: {mantel_results[0]}, p-value: {mantel_results[1]}")

# Differential abundance on a feature table (raw counts recommended)
from skbio.stats.composition import dirmult_ttest
da = dirmult_ttest(counts_table, grouping, treatment='caseA', reference='control')

Important notes:

  • Permutation tests provide non-parametric significance testing
  • Use 999+ permutations for robust p-values
  • PERMANOVA sensitive to dispersion differences; pair with PERMDISP
  • Mantel tests assess matrix correlation (e.g., geographic vs genetic distance)
  • Supply differential-abundance tests with raw counts, not pre-normalized proportions, to preserve magnitude information

7. File I/O and Format Conversion

Read and write 19+ biological file formats with automatic format detection.

Supported formats:

  • Sequences: FASTA, FASTQ, GenBank, EMBL, QSeq
  • Alignments: Clustal, PHYLIP, Stockholm
  • Trees: Newick
  • Tables: BIOM (HDF5 and JSON)
  • Distances: delimited square matrices
  • Analysis: BLAST+6/7, GFF3, Ordination results
  • Metadata: TSV/CSV with validation

Common patterns:

import skbio

# Read with automatic format detection
seq = skbio.DNA.read('file.fasta', format='fasta')
tree = skbio.TreeNode.read('tree.nwk')

# Write to file
seq.write('output.fasta', format='fasta')

# Generator for large files (memory efficient)
for seq in skbio.io.read('large.fasta', format='fasta', constructor=skbio.DNA):
    process(seq)

# Convert formats
seqs = list(skbio.io.read('input.fastq', format='fastq', constructor=skbio.DNA))
skbio.io.write(seqs, format='fasta', into='output.fasta')

Important notes:

  • Use generators for large files to avoid memory issues
  • Format can be auto-detected when into parameter specified
  • Some objects can be written to multiple formats
  • Support for stdin/stdout piping with verify=False

8. Distance Matrices

Create and manipulate distance/dissimilarity matrices with statistical methods.

Key capabilities:

  • Store symmetric (DistanceMatrix, hollow diagonal) or general pairwise (PairwiseMatrix) data
  • ID-based indexing and slicing
  • Integration with diversity, ordination, and statistical tests
  • Read/write delimited text format

Common patterns:

from skbio import DistanceMatrix
import numpy as np

# Create from array
data = np.array([[0, 1, 2], [1, 0, 3], [2, 3, 0]])
dm = DistanceMatrix(data, ids=['A', 'B', 'C'])

# Access distances
dist_ab = dm['A', 'B']
row_a = dm['A']

# Read from file
dm = DistanceMatrix.read('distances.txt')

# Use in downstream analyses
pcoa_results = pcoa(dm)
permanova_results = permanova(dm, grouping)

Important notes:

  • DistanceMatrix enforces symmetry and a zero (hollow) diagonal; it is a subclass of SymmetricMatrix
  • PairwiseMatrix (renamed from DissimilarityMatrix, which is kept as a deprecated alias) allows general/asymmetric values
  • IDs enable integration with metadata and biological knowledge
  • Compatible with pandas, numpy, and scikit-learn

9. Biological Tables

Work with feature tables (OTU/ASV tables) common in microbiome research.

Key capabilities:

  • BIOM format I/O (HDF5 and JSON) via the native Table class
  • Table dispatch system (0.7.0+): functions accept any table_like input — BIOM Table, pandas/polars DataFrame, NumPy array, or AnnData — without explicit conversion
  • Data augmentation techniques (phylomix, mixup, aitchison_mixup, compos_cutmix)
  • Sample/feature filtering and normalization
  • Metadata integration

Common patterns:

from skbio import Table
from skbio.diversity import beta_diversity

# Read BIOM table
table = Table.read('table.biom')

# Access data
sample_ids = table.ids(axis='sample')
feature_ids = table.ids(axis='observation')
counts = table.matrix_data

# Filter
filtered = table.filter(sample_ids_to_keep, axis='sample')

# Pass table-like objects directly to scikit-bio drivers (dispatch system)
import pandas as pd
df = pd.read_table('data.tsv', index_col=0)   # samples x features
bdiv = beta_diversity('braycurtis', df)         # no manual conversion needed

Important notes:

  • BIOM tables are standard in QIIME 2 workflows
  • Rows typically represent samples, columns represent features (OTUs/ASVs)
  • Supports sparse and dense representations
  • With the dispatch system, functions return the same format as their input, or a user-specified output format

10. Protein Embeddings

Work with protein language model embeddings for downstream analysis.

Key capabilities:

  • Store embeddings from protein language models (ESM, ProtTrans, etc.)
  • Convert embeddings to distance matrices
  • Generate ordination objects for visualization
  • Export to numpy/pandas for ML workflows

Common patterns:

from skbio.embedding import ProteinEmbedding, ProteinVector

# Create embedding from array
embedding = ProteinEmbedding(embedding_array, sequence_ids)

# Convert to distance matrix for analysis
dm = embedding.to_distances(metric='euclidean')

# PCoA visualization of embedding space
pcoa_results = embedding.to_ordination(metric='euclidean', method='pcoa')

# Export for machine learning
array = embedding.to_array()
df = embedding.to_dataframe()

Important notes:

  • Embeddings bridge protein language models with traditional bioinformatics
  • Compatible with scikit-bio's distance/ordination/statistics ecosystem
  • SequenceEmbedding and ProteinEmbedding provide specialized functionality
  • Useful for sequence clustering, classification, and visualization

Best Practices

Installation

uv pip install scikit-bio

Requires Python 3.10+ and NumPy 2.0+. Pre-compiled wheels are published for each release since 0.7.0, so most platforms install without a compiler. Conda users can instead run conda install -c conda-forge scikit-bio.

Performance Considerations

  • Use generators for large sequence files to minimize memory usage
  • For massive phylogenetic trees, prefer GME or BME over NJ
  • Beta diversity calculations can be parallelized with partial_beta_diversity()
  • BIOM format (HDF5) more efficient than JSON for large tables

Integration with Ecosystem

  • Sequences interoperate with Biopython via standard formats
  • Tables integrate with pandas, polars, and AnnData
  • Distance matrices compatible with scikit-learn
  • Ordination results visualizable with matplotlib/seaborn/plotly
  • Works seamlessly with QIIME 2 artifacts (BIOM, trees, distance matrices)

Common Workflows

  1. Microbiome diversity analysis: Read BIOM table → Calculate alpha/beta diversity → Ordination (PCoA) → Statistical testing (PERMANOVA)
  2. Phylogenetic analysis: Read sequences → Align → Build distance matrix → Construct tree → Calculate phylogenetic distances
  3. Sequence processing: Read FASTQ → Quality filter → Trim/clean → Find motifs → Translate → Write FASTA
  4. Comparative genomics: Read sequences → Pairwise alignment → Calculate distances → Build tree → Analyze clades

Reference Documentation

For detailed API information, parameter specifications, and advanced usage examples, refer to references/api_reference.md which contains comprehensive documentation on:

  • Complete method signatures and parameters for all capabilities
  • Extended code examples for complex workflows
  • Troubleshooting common issues
  • Performance optimization tips
  • Integration patterns with other libraries

Additional Resources

附带文件

references/api_reference.md
# scikit-bio API Reference

This document provides detailed API information, advanced examples, and troubleshooting guidance for working with scikit-bio.

## Table of Contents
1. [Sequence Classes](#sequence-classes)
2. [Alignment Methods](#alignment-methods)
3. [Phylogenetic Trees](#phylogenetic-trees)
4. [Diversity Metrics](#diversity-metrics)
5. [Ordination](#ordination)
6. [Statistical Tests](#statistical-tests)
7. [Distance Matrices](#distance-matrices)
8. [File I/O](#file-io)
9. [Troubleshooting](#troubleshooting)

## Sequence Classes

### DNA, RNA, and Protein Classes

```python
from skbio import DNA, RNA, Protein, Sequence

# Creating sequences
dna = DNA('ATCGATCG', metadata={'id': 'seq1', 'description': 'Example'})
rna = RNA('AUCGAUCG')
protein = Protein('ACDEFGHIKLMNPQRSTVWY')

# Sequence operations
dna_rc = dna.reverse_complement()  # Reverse complement
rna = dna.transcribe()  # DNA -> RNA
protein = rna.translate()  # RNA -> Protein

# Using genetic code tables
protein = rna.translate(genetic_code=11)  # Bacterial code
```

### Sequence Searching and Pattern Matching

```python
# Find motifs using regex
dna = DNA('ATGCGATCGATGCATCG')
motif_locs = dna.find_with_regex('ATG.{3}')  # Start codons

# Find all positions
import re
for match in re.finditer('ATG', str(dna)):
    print(f"ATG found at position {match.start()}")

# k-mer counting
from skbio.sequence import _motifs
kmers = dna.kmer_frequencies(k=3)
```

### Handling Sequence Metadata

```python
# Sequence-level metadata
dna = DNA('ATCG', metadata={'id': 'seq1', 'source': 'E. coli'})
print(dna.metadata['id'])

# Positional metadata (per-base quality scores from FASTQ)
from skbio import DNA
seqs = DNA.read('reads.fastq', format='fastq', phred_offset=33)
quality_scores = seqs.positional_metadata['quality']

# Interval metadata (features/annotations)
dna.interval_metadata.add([(5, 15)], metadata={'type': 'gene', 'name': 'geneA'})
```

### Distance Calculations

```python
from skbio import DNA

seq1 = DNA('ATCGATCG')
seq2 = DNA('ATCG--CG')

# Hamming distance (default)
dist = seq1.distance(seq2)

# Custom distance function
from skbio.sequence.distance import kmer_distance
dist = seq1.distance(seq2, metric=kmer_distance)
```

## Alignment Methods

### Pairwise Alignment

scikit-bio 0.7.0 introduced `pair_align`, a single fast engine for global, local, and semi-global alignment. The convenience wrappers `pair_align_nucl` and `pair_align_prot` ship with BLASTN/BLASTP-like scoring. The old SSW wrapper (`local_pairwise_align_ssw`, `StripedSmithWaterman`) was removed, and the pure-Python `global_pairwise_align`/`local_pairwise_align_*` functions are deprecated.

```python
from skbio import DNA, Protein
from skbio.alignment import pair_align_nucl, pair_align_prot, pair_align, align_score

# Nucleotide alignment with BLASTN-like defaults
seq1 = DNA('ATCGATCGATCG')
seq2 = DNA('ATCGGGGATCG')
aln = pair_align_nucl(seq1, seq2)

# Inspect the result (PairAlignResult: score + paths [+ matrices])
print(f"Score: {aln.score}")
path = aln.paths[0]                       # PairAlignPath; repr shows the CIGAR
aligned_seqs = path.to_aligned((seq1, seq2))   # list of gapped strings

# Global alignment with custom affine scoring via pair_align
aln = pair_align(
    seq1, seq2,
    mode='global',          # 'global' (default), 'local', or semi-global via free_ends
    sub_score=(2, -3),      # (match, mismatch)
    gap_cost=(5, 2),        # (open, extend) -> affine; a single number -> linear
)

# Use a named substitution matrix instead of match/mismatch scores
aln = pair_align(seq1, seq2, mode='global', sub_score='NUC.4.4', gap_cost=3)

# Protein alignment with BLASTP-like defaults (BLOSUM62)
protein_query = Protein('ACDEFGHIKLMNPQRSTVWY')
protein_target = Protein('ACDEFMNPQRSTVWY')
aln = pair_align_prot(protein_query, protein_target)

# Re-score an existing alignment with the same parameters
score = align_score((aln.paths[0], (protein_query, protein_target)),
                    sub_score='BLOSUM62', gap_cost=(11, 1))

# PairAlignResult also unpacks as a tuple
score, (path,), _ = pair_align_nucl(seq1, seq2)
```

### Multiple Sequence Alignment

```python
from skbio.alignment import TabularMSA, pair_align_nucl
from skbio import DNA

# Read MSA from file
msa = TabularMSA.read('alignment.fasta', constructor=DNA)

# Build a TabularMSA from a pairwise alignment path + original sequences
score, (path,), _ = pair_align_nucl(DNA('ATCGATCG'), DNA('ATCGGGGATCG'))
msa = TabularMSA.from_path_seqs(path, (DNA('ATCGATCG'), DNA('ATCGGGGATCG')))

# Create MSA manually
seqs = [
    DNA('ATCG--'),
    DNA('ATGG--'),
    DNA('ATCGAT')
]
msa = TabularMSA(seqs)

# MSA operations
consensus = msa.consensus()
majority_consensus = msa.majority_consensus()

# Calculate conservation
conservation = msa.conservation()

# Access sequences
first_seq = msa[0]
column = msa[:, 2]  # Third column

# Filter gaps
degapped_msa = msa.omit_gap_positions(maximum_gap_frequency=0.5)

# Calculate position-specific scores
position_entropies = msa.position_entropies()
```

### CIGAR Strings and Alignment Paths

```python
from skbio.alignment import PairAlignPath, AlignPath, pair_align_nucl
from skbio import DNA

# Parse a CIGAR string into a pairwise alignment path
path = PairAlignPath.from_cigar('10M2I5M3D10M')
print(repr(path))   # <PairAlignPath, ..., CIGAR: '10M2I5M3D10M'>

# A path produced by pair_align already carries its CIGAR
aln = pair_align_nucl(DNA('ATCGATCG'), DNA('ATCGGGGATCG'))
cigar_string = aln.paths[0].cigar

# AlignPath generalizes to >2 sequences (e.g., from aligned strings)
path3 = AlignPath.from_aligned(['CGTCGTGC', 'CA--GT-C', 'CGTCGT-T'])

# Parse CIGAR output from external tools such as parasail
# path = PairAlignPath.from_cigar(res.cigar.decode)
```

## Phylogenetic Trees

### Tree Construction

```python
from skbio import TreeNode, DistanceMatrix
from skbio.tree import nj, upgma

# Distance matrix
dm = DistanceMatrix([[0, 5, 9, 9],
                     [5, 0, 10, 10],
                     [9, 10, 0, 8],
                     [9, 10, 8, 0]],
                    ids=['A', 'B', 'C', 'D'])

# Neighbor joining
nj_tree = nj(dm)

# UPGMA (assumes molecular clock)
upgma_tree = upgma(dm)

# Balanced Minimum Evolution (scalable for large trees)
from skbio.tree import bme
bme_tree = bme(dm)
```

### Tree Manipulation

```python
from skbio import TreeNode

# Read tree
tree = TreeNode.read('tree.nwk', format='newick')

# Traversal
for node in tree.traverse():
    print(node.name)

# Preorder, postorder, levelorder
for node in tree.preorder():
    print(node.name)

# Get tips only
tips = list(tree.tips())

# Find specific node
node = tree.find('taxon_name')

# Root tree at midpoint
rooted_tree = tree.root_at_midpoint()

# Prune tree to specific taxa
pruned = tree.shear(['taxon1', 'taxon2', 'taxon3'])

# Get subtree
lca = tree.lowest_common_ancestor(['taxon1', 'taxon2'])
subtree = lca.copy()

# Add/remove nodes
parent = tree.find('parent_name')
child = TreeNode(name='new_child', length=0.5)
parent.append(child)

# Remove node
node_to_remove = tree.find('taxon_to_remove')
node_to_remove.parent.remove(node_to_remove)
```

### Tree Distances and Comparisons

```python
# Patristic distance (branch-length distance) between two nodes
node1 = tree.find('taxon1')
node2 = tree.find('taxon2')
patristic = node1.distance(node2)

# Cophenetic (patristic) distance matrix among all tips
# cophenet() replaces the former tip_tip_distances()
cophenetic_dm = tree.cophenet()

# Robinson-Foulds distance between two trees (compare_rfd, added in 0.6.3)
rf_dist = tree.compare_rfd(other_tree)              # count (float)
rf_prop = tree.compare_rfd(other_tree, proportion=True)  # normalized to [0, 1]

# Weighted Robinson-Foulds and cophenetic-correlation comparisons
wrf = tree.compare_wrfd(other_tree)
coph = tree.compare_cophenet(other_tree)

# Pairwise RF distances among many trees -> DistanceMatrix
from skbio.tree import rf_dists
rf_dm = rf_dists([tree, other_tree, third_tree])
```

### Tree Visualization

```python
# ASCII art visualization
print(tree.ascii_art())

# For advanced visualization, export to external tools
tree.write('tree.nwk', format='newick')

# Then use ete3, toytree, or ggtree for publication-quality figures
```

## Diversity Metrics

### Alpha Diversity

```python
from skbio.diversity import alpha_diversity, get_alpha_diversity_metrics
import numpy as np

# Sample count data (samples x features)
counts = np.array([
    [10, 5, 0, 3],
    [2, 0, 8, 4],
    [5, 5, 5, 5]
])
sample_ids = ['Sample1', 'Sample2', 'Sample3']

# List available metrics
print(get_alpha_diversity_metrics())

# Calculate various alpha diversity metrics
shannon = alpha_diversity('shannon', counts, ids=sample_ids)
simpson = alpha_diversity('simpson', counts, ids=sample_ids)
observed = alpha_diversity('observed_features', counts, ids=sample_ids)  # was 'observed_otus'
chao1 = alpha_diversity('chao1', counts, ids=sample_ids)
hill_q2 = alpha_diversity('hill', counts, ids=sample_ids)  # effective number of species

# Phylogenetic alpha diversity (requires tree). Note: taxa= replaces otu_ids=
from skbio import TreeNode

tree = TreeNode.read('tree.nwk')
feature_ids = ['OTU1', 'OTU2', 'OTU3', 'OTU4']

faith_pd = alpha_diversity('faith_pd', counts, ids=sample_ids,
                           tree=tree, taxa=feature_ids)
```

### Beta Diversity

```python
from skbio.diversity import beta_diversity, partial_beta_diversity

# Beta diversity (all pairwise comparisons)
bc_dm = beta_diversity('braycurtis', counts, ids=sample_ids)

# Jaccard (presence/absence)
jaccard_dm = beta_diversity('jaccard', counts, ids=sample_ids)

# Phylogenetic beta diversity (taxa= replaces the deprecated otu_ids=)
unifrac_dm = beta_diversity('unweighted_unifrac', counts,
                            ids=sample_ids,
                            tree=tree,
                            taxa=feature_ids)

weighted_unifrac_dm = beta_diversity('weighted_unifrac', counts,
                                     ids=sample_ids,
                                     tree=tree,
                                     taxa=feature_ids)

# Compute only specific pairs (more efficient)
pairs = [('Sample1', 'Sample2'), ('Sample1', 'Sample3')]
partial_dm = partial_beta_diversity('braycurtis', counts,
                                   ids=sample_ids,
                                   id_pairs=pairs)
```

### Rarefaction and Subsampling

```python
from skbio.diversity import subsample_counts

# Rarefy to minimum depth
min_depth = counts.min(axis=1).max()
rarefied = [subsample_counts(row, n=min_depth) for row in counts]

# Multiple rarefactions for confidence intervals
import numpy as np
rarefactions = []
for i in range(100):
    rarefied_counts = np.array([subsample_counts(row, n=1000) for row in counts])
    shannon_rare = alpha_diversity('shannon', rarefied_counts)
    rarefactions.append(shannon_rare)

# Calculate mean and std
mean_shannon = np.mean(rarefactions, axis=0)
std_shannon = np.std(rarefactions, axis=0)
```

## Ordination

### Principal Coordinate Analysis (PCoA)

```python
from skbio.stats.ordination import pcoa
from skbio import DistanceMatrix
import numpy as np

# PCoA from distance matrix
dm = DistanceMatrix(...)
pcoa_results = pcoa(dm)

# Access coordinates
pc1 = pcoa_results.samples['PC1']
pc2 = pcoa_results.samples['PC2']

# Proportion explained
prop_explained = pcoa_results.proportion_explained

# Eigenvalues
eigenvalues = pcoa_results.eigvals

# Save results
pcoa_results.write('pcoa_results.txt')

# Plot with matplotlib
import matplotlib.pyplot as plt
plt.scatter(pc1, pc2)
plt.xlabel(f'PC1 ({prop_explained[0]*100:.1f}%)')
plt.ylabel(f'PC2 ({prop_explained[1]*100:.1f}%)')
```

### Canonical Correspondence Analysis (CCA)

```python
from skbio.stats.ordination import cca
import pandas as pd
import numpy as np

# Species abundance matrix (samples x species)
species = np.array([
    [10, 5, 3],
    [2, 8, 4],
    [5, 5, 5]
])

# Environmental variables (samples x variables)
env = pd.DataFrame({
    'pH': [6.5, 7.0, 6.8],
    'temperature': [20, 25, 22],
    'depth': [10, 15, 12]
})

# CCA
cca_results = cca(species, env,
                 sample_ids=['Site1', 'Site2', 'Site3'],
                 species_ids=['SpeciesA', 'SpeciesB', 'SpeciesC'])

# Access constrained axes
cca1 = cca_results.samples['CCA1']
cca2 = cca_results.samples['CCA2']

# Biplot scores for environmental variables
env_scores = cca_results.biplot_scores
```

### Redundancy Analysis (RDA)

```python
from skbio.stats.ordination import rda

# Similar to CCA but for linear relationships
rda_results = rda(species, env,
                 sample_ids=['Site1', 'Site2', 'Site3'],
                 species_ids=['SpeciesA', 'SpeciesB', 'SpeciesC'])
```

## Statistical Tests

### PERMANOVA

```python
from skbio.stats.distance import permanova
from skbio import DistanceMatrix
import numpy as np

# Distance matrix
dm = DistanceMatrix(...)

# Grouping variable
grouping = ['Group1', 'Group1', 'Group2', 'Group2', 'Group3', 'Group3']

# Run PERMANOVA
results = permanova(dm, grouping, permutations=999)

print(f"Test statistic: {results['test statistic']}")
print(f"p-value: {results['p-value']}")
print(f"Sample size: {results['sample size']}")
print(f"Number of groups: {results['number of groups']}")
```

### ANOSIM

```python
from skbio.stats.distance import anosim

# ANOSIM test
results = anosim(dm, grouping, permutations=999)

print(f"R statistic: {results['test statistic']}")
print(f"p-value: {results['p-value']}")
```

### PERMDISP

```python
from skbio.stats.distance import permdisp

# Test homogeneity of dispersions
results = permdisp(dm, grouping, permutations=999)

print(f"F statistic: {results['test statistic']}")
print(f"p-value: {results['p-value']}")
```

### Mantel Test

```python
from skbio.stats.distance import mantel
from skbio import DistanceMatrix

# Two distance matrices to compare
dm1 = DistanceMatrix(...)  # e.g., genetic distance
dm2 = DistanceMatrix(...)  # e.g., geographic distance

# Mantel test
r, p_value, n = mantel(dm1, dm2, method='pearson', permutations=999)

print(f"Correlation: {r}")
print(f"p-value: {p_value}")
print(f"Sample size: {n}")

# Spearman correlation
r_spearman, p, n = mantel(dm1, dm2, method='spearman', permutations=999)
```

### Partial Mantel Test

```python
from skbio.stats.distance import mantel

# Control for a third matrix
dm3 = DistanceMatrix(...)  # controlling variable

r_partial, p_value, n = mantel(dm1, dm2, method='pearson',
                               permutations=999, alternative='two-sided')
```

## Distance Matrices

### Creating and Manipulating Distance Matrices

```python
from skbio import DistanceMatrix
from skbio.stats.distance import PairwiseMatrix
import numpy as np

# Create from array
data = np.array([[0, 1, 2],
                 [1, 0, 3],
                 [2, 3, 0]])
dm = DistanceMatrix(data, ids=['A', 'B', 'C'])

# Access elements
dist_ab = dm['A', 'B']
row_a = dm['A']

# Slicing
subset_dm = dm.filter(['A', 'C'])

# General/asymmetric matrix: PairwiseMatrix (renamed from DissimilarityMatrix,
# which is kept as a deprecated alias)
asym_data = np.array([[0, 1, 2],
                      [3, 0, 4],
                      [5, 6, 0]])
pwm = PairwiseMatrix(asym_data, ids=['X', 'Y', 'Z'])

# Read/write
dm.write('distances.txt')
dm2 = DistanceMatrix.read('distances.txt')

# Convert to condensed form (for scipy)
condensed = dm.condensed_form()

# Convert to dataframe
df = dm.to_data_frame()
```

## File I/O

### Reading Sequences

```python
import skbio

# Read single sequence
dna = skbio.DNA.read('sequence.fasta', format='fasta')

# Read multiple sequences (generator)
for seq in skbio.io.read('sequences.fasta', format='fasta', constructor=skbio.DNA):
    print(seq.metadata['id'], len(seq))

# Read into list
sequences = list(skbio.io.read('sequences.fasta', format='fasta',
                               constructor=skbio.DNA))

# Read FASTQ with quality scores
for seq in skbio.io.read('reads.fastq', format='fastq', constructor=skbio.DNA):
    quality = seq.positional_metadata['quality']
    print(f"Mean quality: {quality.mean()}")
```

### Writing Sequences

```python
# Write single sequence
dna.write('output.fasta', format='fasta')

# Write multiple sequences
sequences = [dna1, dna2, dna3]
skbio.io.write(sequences, format='fasta', into='output.fasta')

# Write with custom line wrapping
dna.write('output.fasta', format='fasta', max_width=60)
```

### BIOM Tables

```python
from skbio import Table

# Read BIOM table
table = Table.read('table.biom', format='hdf5')

# Access data
sample_ids = table.ids(axis='sample')
feature_ids = table.ids(axis='observation')
matrix = table.matrix_data.toarray()  # if sparse

# Filter samples
abundant_samples = table.filter(lambda row, id_, md: row.sum() > 1000, axis='sample')

# Filter features (OTUs/ASVs)
prevalent_features = table.filter(lambda col, id_, md: (col > 0).sum() >= 3,
                                 axis='observation')

# Normalize
relative_abundance = table.norm(axis='sample', inplace=False)

# Write
table.write('filtered_table.biom', format='hdf5')
```

### Format Conversion

```python
# FASTQ to FASTA
seqs = skbio.io.read('input.fastq', format='fastq', constructor=skbio.DNA)
skbio.io.write(seqs, format='fasta', into='output.fasta')

# GenBank to FASTA
seqs = skbio.io.read('genes.gb', format='genbank', constructor=skbio.DNA)
skbio.io.write(seqs, format='fasta', into='genes.fasta')
```

## Troubleshooting

### Common Issues and Solutions

#### Issue: "ValueError: Ids must be unique"
```python
# Problem: Duplicate sequence IDs
# Solution: Make IDs unique or filter duplicates
seen = set()
unique_seqs = []
for seq in sequences:
    if seq.metadata['id'] not in seen:
        unique_seqs.append(seq)
        seen.add(seq.metadata['id'])
```

#### Issue: "ValueError: Counts must be integers"
```python
# Problem: Relative abundances instead of counts
# Solution: Convert to integer counts or use appropriate metrics
counts_int = (abundance_table * 1000).astype(int)
```

#### Issue: Memory error with large files
```python
# Problem: Loading entire file into memory
# Solution: Use generators
for seq in skbio.io.read('huge.fasta', format='fasta', constructor=skbio.DNA):
    # Process one at a time
    process(seq)
```

#### Issue: Tree tips don't match OTU IDs
```python
# Problem: Mismatch between tree tip names and feature IDs
# Solution: Verify and align IDs
tree_tips = {tip.name for tip in tree.tips()}
feature_ids = set(feature_ids)
missing_in_tree = feature_ids - tree_tips
missing_in_table = tree_tips - feature_ids

# Prune tree to match table
tree_pruned = tree.shear(feature_ids)
```

#### Issue: Alignment fails with sequences of different lengths
```python
# Problem: Trying to align pre-aligned sequences
# Solution: Degap sequences first or ensure sequences are unaligned
seq1_degapped = seq1.degap()
seq2_degapped = seq2.degap()
alignment = pair_align_nucl(seq1_degapped, seq2_degapped)
```

### Performance Tips

1. **Use appropriate data structures**: BIOM HDF5 for large tables, generators for large sequence files
2. **Parallel processing**: Use `partial_beta_diversity()` for subset calculations that can be parallelized
3. **Subsample large datasets**: For exploratory analysis, work with subsampled data first
4. **Cache results**: Save distance matrices and ordination results to avoid recomputation

### Integration Examples

#### With pandas
```python
import pandas as pd
from skbio import DistanceMatrix

# Distance matrix to DataFrame
dm = DistanceMatrix(...)
df = dm.to_data_frame()

# Alpha diversity to DataFrame
alpha = alpha_diversity('shannon', counts, ids=sample_ids)
alpha_df = pd.DataFrame({'shannon': alpha})
```

#### With matplotlib/seaborn
```python
import matplotlib.pyplot as plt
import seaborn as sns

# PCoA plot
fig, ax = plt.subplots()
scatter = ax.scatter(pc1, pc2, c=grouping, cmap='viridis')
ax.set_xlabel(f'PC1 ({prop_explained[0]*100:.1f}%)')
ax.set_ylabel(f'PC2 ({prop_explained[1]*100:.1f}%)')
plt.colorbar(scatter)

# Heatmap of distance matrix
sns.heatmap(dm.to_data_frame(), cmap='viridis')
```

#### With QIIME 2
```python
# scikit-bio objects are compatible with QIIME 2
# Export from QIIME 2
# qiime tools export --input-path table.qza --output-path exported/

# Read in scikit-bio
table = Table.read('exported/feature-table.biom')

# Process with scikit-bio
# ...

# Import back to QIIME 2 if needed
table.write('processed-table.biom')
# qiime tools import --input-path processed-table.biom --output-path processed.qza
```